View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0822_low_10 (Length: 218)
Name: NF0822_low_10
Description: NF0822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0822_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 54; Significance: 3e-22; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 32726656 - 32726599
Alignment:
Q |
1 |
aacacatggatatcaagatacaaatacttgtgatatttaggtttaagagattcttcct |
58 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
32726656 |
aacacatggatatcaagatacaaatacttgcgatatttaggtttaagagattcttcct |
32726599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 6 - 56
Target Start/End: Complemental strand, 35981084 - 35981034
Alignment:
Q |
6 |
atggatatcaagatacaaatacttgtgatatttaggtttaagagattcttc |
56 |
Q |
|
|
|||||||||||||||||||||||| ||||||||| |||||| ||||||| |
|
|
T |
35981084 |
atggatatcaagatacaaatacttaagatatttagatttaagtaattcttc |
35981034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 6 - 56
Target Start/End: Complemental strand, 36002496 - 36002446
Alignment:
Q |
6 |
atggatatcaagatacaaatacttgtgatatttaggtttaagagattcttc |
56 |
Q |
|
|
|||||||||||||||||||||||| ||||||||| |||||| ||||||| |
|
|
T |
36002496 |
atggatatcaagatacaaatacttaagatatttagatttaagtaattcttc |
36002446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 56
Target Start/End: Original strand, 26329630 - 26329681
Alignment:
Q |
5 |
catggatatcaagatacaaatacttgtgatatttaggtttaagagattcttc |
56 |
Q |
|
|
|||||||||||||||||||||||||| | ||||||| |||||| |||||||| |
|
|
T |
26329630 |
catggatatcaagatacaaatacttgcgctatttagatttaagtgattcttc |
26329681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University