View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0822_low_2 (Length: 454)
Name: NF0822_low_2
Description: NF0822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0822_low_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 83 - 356
Target Start/End: Complemental strand, 33907642 - 33907366
Alignment:
| Q |
83 |
gaacaataagaggtgtttgatgaagtccaatgattaaggtttggtggattttgaaaatgttgttttattttcattaggatttcatgttcttgattatgaa |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
33907642 |
gaacaataagaggtgtttgatgaagtccaatgattaaggtttggtggattttgaaaatgttgttttattttcattagggtttcatgttcttggttatgaa |
33907543 |
T |
 |
| Q |
183 |
gattttgttgagattgagattttgcatggtttagaattatgaggaaaaatgttagaagatagtgaaatgaaaatgttgatattttcattttggtattgag |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33907542 |
gattttgttgagattgagattttgcatggtttagaattatgaggaaaaatgtaagaagatggtgaaatgaaaatgttgatattttcattttggtgttgat |
33907443 |
T |
 |
| Q |
283 |
aggnnnnnnncctttctgatttttagtgttttgtgcattgaaaataggaggt---gtaggaaaatggttgtgttttg |
356 |
Q |
| |
|
|| ||||||| |||||| ||||||||||||||||||| |||||| | |||||||||||||||||||| |
|
|
| T |
33907442 |
agtttttctatctttctggtttttattgttttgtgcattgaaaatgggaggtataggaggaaaatggttgtgttttg |
33907366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 127 - 177
Target Start/End: Complemental strand, 33914760 - 33914710
Alignment:
| Q |
127 |
tggattttgaaaatgttgttttattttcattaggatttcatgttcttgatt |
177 |
Q |
| |
|
||||||||||||||| | ||||||||| | ||||||||||||||||||||| |
|
|
| T |
33914760 |
tggattttgaaaatggttttttatttttaataggatttcatgttcttgatt |
33914710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University