View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0822_low_6 (Length: 331)
Name: NF0822_low_6
Description: NF0822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0822_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 29 - 134
Target Start/End: Complemental strand, 40469799 - 40469694
Alignment:
| Q |
29 |
agaaagattacaaaaaattaagagcataaatgttatcatagtggcaaacttgttgctgatcaaaatttggcgtgtttggtgacaagtttttcttatcaac |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40469799 |
agaaagattacaaaaaattaagagcataaatgatatcatagtggcaaacttgttgctgatcaaaatttggcgtgtttgatgacaagtttttcttatcaac |
40469700 |
T |
 |
| Q |
129 |
ttgtaa |
134 |
Q |
| |
|
|||||| |
|
|
| T |
40469699 |
ttgtaa |
40469694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 151 - 187
Target Start/End: Original strand, 25483705 - 25483741
Alignment:
| Q |
151 |
atttcaattagtttttgaacttatagtttatagcttt |
187 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
25483705 |
atttcaagtagtttttgagcttatagtttatagcttt |
25483741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University