View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0822_low_7 (Length: 265)
Name: NF0822_low_7
Description: NF0822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0822_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 74; Significance: 5e-34; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 4 - 85
Target Start/End: Complemental strand, 21706665 - 21706584
Alignment:
Q |
4 |
tatttcaagacttcttaattttggaagcattttgctcatagaaacagggaaaaggcttttcaacttgttgcagcctccgact |
85 |
Q |
|
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21706665 |
tatttcaagactgcttaattttggaagcattttcctcatagaaacagggaaaaggcttttcaacttgttgcagcctccgact |
21706584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 17 - 75
Target Start/End: Original strand, 21712812 - 21712870
Alignment:
Q |
17 |
cttaattttggaagcattttgctcatagaaacagggaaaaggcttttcaacttgttgca |
75 |
Q |
|
|
||||||| ||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
T |
21712812 |
cttaattgcggaagcattttaaccatagcaacagggaaaaggcttttcaacttgttgca |
21712870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 17 - 68
Target Start/End: Complemental strand, 21709534 - 21709483
Alignment:
Q |
17 |
cttaattttggaagcattttgctcatagaaacagggaaaaggcttttcaact |
68 |
Q |
|
|
||||||| |||||||||||| |||||| |||| |||||||||||||||||| |
|
|
T |
21709534 |
cttaattgtggaagcattttaatcatagtaacaaggaaaaggcttttcaact |
21709483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 77
Target Start/End: Complemental strand, 21125507 - 21125479
Alignment:
Q |
49 |
agggaaaaggcttttcaacttgttgcagc |
77 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
21125507 |
agggaaaaggcttttcaacttgttgcagc |
21125479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 210 - 260
Target Start/End: Original strand, 35443214 - 35443264
Alignment:
Q |
210 |
aaaaaaggtaaagaacacatgtgattcctctgtttattttcgcacaattct |
260 |
Q |
|
|
||||||||||||||||| | ||||||||| |||||||||||||| |||||| |
|
|
T |
35443214 |
aaaaaaggtaaagaacaaaggtgattcctttgtttattttcgcaaaattct |
35443264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University