View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0823_high_10 (Length: 255)
Name: NF0823_high_10
Description: NF0823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0823_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 49016276 - 49016157
Alignment:
| Q |
1 |
gtcaatggatctttactacggtaatatgtgatgtcgaaattcacagcatcctctgtgtttcccaagtatgcactagaagttgtaacgtagcgcataagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49016276 |
gtcaatggatctttactacggtaatatgtgatgtcgaaatccacagcat--tctgtgtttcccaagtatgcactagaagttgtaacgtagcgcataagga |
49016179 |
T |
 |
| Q |
101 |
ttccattgtatagatctaagcc |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
49016178 |
ttccattgtatagatctaagcc |
49016157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 490478 - 490602
Alignment:
| Q |
1 |
gtcaatggatctttactacggtaatatgtgatgtcgaaattcacagcatcctctgtgtttcccaagtatgcactagaagttgtaacgtagcgcataagga |
100 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||| || | ||||||||| ||||| ||||||||||||||||||||||||||||| || ||||| |||| |
|
|
| T |
490478 |
gtcaatggatctttactgcggtaatatatgatgtcaaattccacagcatcttctgtttttcccaagtatgcactagaagttgtaacataacgcatgagga |
490577 |
T |
 |
| Q |
101 |
ttccattgtatagatctaagccaca |
125 |
Q |
| |
|
|||||||||| | ||||||||||| |
|
|
| T |
490578 |
ttccattgtacaagtctaagccaca |
490602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 6 - 111
Target Start/End: Complemental strand, 9071974 - 9071869
Alignment:
| Q |
6 |
tggatctttactacggtaatatgtgatgtcgaaattcacagcatcctctgtgtttcccaagtatgcactagaagttgtaacgtagcgcataaggattcca |
105 |
Q |
| |
|
||||||||| ||||| ||||||||||| || || | | ||||||||| |||||| | ||| |||||||||| |||||| || ||||| || |||||| |
|
|
| T |
9071974 |
tggatctttgctacgataatatgtgatatcaaagtctaatgcatcctcttggtttcctaggtaagcactagaagctgtaacataacgcattagaattcca |
9071875 |
T |
 |
| Q |
106 |
ttgtat |
111 |
Q |
| |
|
|||||| |
|
|
| T |
9071874 |
ttgtat |
9071869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University