View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0823_low_1 (Length: 430)
Name: NF0823_low_1
Description: NF0823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0823_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 4e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 250 - 401
Target Start/End: Original strand, 3579456 - 3579605
Alignment:
| Q |
250 |
tgaaaattacacccactttggttttgcagtcacattatcttg-tcgaattcggttagggtttgtagttcgaaaattgtaggtcgcgaagcaagcaacaat |
348 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||| | ||||||||||| ||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
3579456 |
tgaaaattacactcactttggttttgcagtcacattatcttggtcgaagttggttagggtttatagttcgaaaattgtaggttgtgaagcaagcaacaat |
3579555 |
T |
 |
| Q |
349 |
atcggaagaagagaacttgttaaaggaagcaaataaacttccatggcaggatc |
401 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3579556 |
---ggaagaagagaacttgttaaaggaagcaaataaacttccatgggaggatc |
3579605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 93 - 144
Target Start/End: Original strand, 3578389 - 3578440
Alignment:
| Q |
93 |
cgtctgttgtgtttttgaagtaaagtgatagaaatgacacaaataattaaaa |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3578389 |
cgtctgttgtgtttttgaagtaaagtgatagaaatgacacaaataattaaaa |
3578440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University