View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0823_low_15 (Length: 209)
Name: NF0823_low_15
Description: NF0823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0823_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 14357386 - 14357254
Alignment:
Q |
1 |
caccaccatcgccatcagtagttggaacttcttcaactgagtgaattgaagcatggctcacgttcatttcttaacccaattgcacttcagttcataatca |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
T |
14357386 |
caccaccatcgccatcagtagttggaacttcttcaactgggtgaattgaagcatggctcaccttcatttcttaacccaattgcacttcaattcataatca |
14357287 |
T |
 |
Q |
101 |
cacactacccaactttttcttcttcgccaaatc |
133 |
Q |
|
|
||||||||||||||||||||||||| ||||||| |
|
|
T |
14357286 |
cacactacccaactttttcttcttcaccaaatc |
14357254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 92; Significance: 7e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 12 - 123
Target Start/End: Complemental strand, 21731117 - 21731006
Alignment:
Q |
12 |
ccatcagtagttggaacttcttcaactgagtgaattgaagcatggctcacgttcatttcttaacccaattgcacttcagttcataatcacacactaccca |
111 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| ||||||| ||||||||||||||| ||||| |
|
|
T |
21731117 |
ccatcagtagttggaacttcttcaactgggtgaattgaagcatggctcacgttcatttcttcacccaattacacttcaattcataatcacacaccaccca |
21731018 |
T |
 |
Q |
112 |
actttttcttct |
123 |
Q |
|
|
|||||||||||| |
|
|
T |
21731017 |
actttttcttct |
21731006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 12 - 133
Target Start/End: Original strand, 5547328 - 5547449
Alignment:
Q |
12 |
ccatcagtagttggaacttcttcaactgagtgaattgaagcatggctcacgttcatttcttaacccaattgcacttcagttcataatcacacactaccca |
111 |
Q |
|
|
|||||| ||||| |||||| |||||||| ||||||||||||||||||||||||||||||| | |||||||||||||| ||||||||| || | ||||| |
|
|
T |
5547328 |
ccatcaatagttcgaactttttcaactggatgaattgaagcatggctcacgttcatttcttcatccaattgcacttcaattcataatctcatgccaccca |
5547427 |
T |
 |
Q |
112 |
actttttcttcttcgccaaatc |
133 |
Q |
|
|
|||||||||||||| ||||||| |
|
|
T |
5547428 |
actttttcttcttcaccaaatc |
5547449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 4 - 133
Target Start/End: Original strand, 29657613 - 29657742
Alignment:
Q |
4 |
caccatcgccatcagtagttggaacttcttcaactgagtgaattgaagcatggctcacgttcatttcttaacccaattgcacttcagttcataatcacac |
103 |
Q |
|
|
||||||| ||||||||||||||||||||||||| | ||||||||||||||||||||| ||||||||||||||||||| ||||||| ||||||||||||| |
|
|
T |
29657613 |
caccatcaccatcagtagttggaacttcttcaatttggtgaattgaagcatggctcacattcatttcttaacccaatttcacttcaattcataatcacac |
29657712 |
T |
 |
Q |
104 |
actacccaactttttcttcttcgccaaatc |
133 |
Q |
|
|
| ||||||||||||||||||| ||||||| |
|
|
T |
29657713 |
atcacccaactttttcttcttcaccaaatc |
29657742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1060 times since January 2019
Visitors: 5824