View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0823_low_15 (Length: 209)

Name: NF0823_low_15
Description: NF0823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0823_low_15
NF0823_low_15
[»] chr5 (1 HSPs)
chr5 (1-133)||(14357254-14357386)
[»] chr4 (2 HSPs)
chr4 (12-123)||(21731006-21731117)
chr4 (12-133)||(5547328-5547449)
[»] chr7 (1 HSPs)
chr7 (4-133)||(29657613-29657742)


Alignment Details
Target: chr5 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 14357386 - 14357254
Alignment:
1 caccaccatcgccatcagtagttggaacttcttcaactgagtgaattgaagcatggctcacgttcatttcttaacccaattgcacttcagttcataatca 100  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||    
14357386 caccaccatcgccatcagtagttggaacttcttcaactgggtgaattgaagcatggctcaccttcatttcttaacccaattgcacttcaattcataatca 14357287  T
101 cacactacccaactttttcttcttcgccaaatc 133  Q
    ||||||||||||||||||||||||| |||||||    
14357286 cacactacccaactttttcttcttcaccaaatc 14357254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 92; Significance: 7e-45; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 12 - 123
Target Start/End: Complemental strand, 21731117 - 21731006
Alignment:
12 ccatcagtagttggaacttcttcaactgagtgaattgaagcatggctcacgttcatttcttaacccaattgcacttcagttcataatcacacactaccca 111  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| ||||||| ||||||||||||||| |||||    
21731117 ccatcagtagttggaacttcttcaactgggtgaattgaagcatggctcacgttcatttcttcacccaattacacttcaattcataatcacacaccaccca 21731018  T
112 actttttcttct 123  Q
    ||||||||||||    
21731017 actttttcttct 21731006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 12 - 133
Target Start/End: Original strand, 5547328 - 5547449
Alignment:
12 ccatcagtagttggaacttcttcaactgagtgaattgaagcatggctcacgttcatttcttaacccaattgcacttcagttcataatcacacactaccca 111  Q
    |||||| ||||| |||||| ||||||||  ||||||||||||||||||||||||||||||| | |||||||||||||| ||||||||| ||  | |||||    
5547328 ccatcaatagttcgaactttttcaactggatgaattgaagcatggctcacgttcatttcttcatccaattgcacttcaattcataatctcatgccaccca 5547427  T
112 actttttcttcttcgccaaatc 133  Q
    |||||||||||||| |||||||    
5547428 actttttcttcttcaccaaatc 5547449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 4 - 133
Target Start/End: Original strand, 29657613 - 29657742
Alignment:
4 caccatcgccatcagtagttggaacttcttcaactgagtgaattgaagcatggctcacgttcatttcttaacccaattgcacttcagttcataatcacac 103  Q
    ||||||| ||||||||||||||||||||||||| |  ||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||||||||||    
29657613 caccatcaccatcagtagttggaacttcttcaatttggtgaattgaagcatggctcacattcatttcttaacccaatttcacttcaattcataatcacac 29657712  T
104 actacccaactttttcttcttcgccaaatc 133  Q
    |  ||||||||||||||||||| |||||||    
29657713 atcacccaactttttcttcttcaccaaatc 29657742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1060 times since January 2019
Visitors: 5824