View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0823_low_6 (Length: 357)
Name: NF0823_low_6
Description: NF0823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0823_low_6 |
 |  |
|
| [»] scaffold0061 (1 HSPs) |
 |  |  |
|
| [»] scaffold0197 (1 HSPs) |
 |  |  |
|
| [»] scaffold0408 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 7)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 10 - 126
Target Start/End: Complemental strand, 5170363 - 5170247
Alignment:
| Q |
10 |
ttccccctgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgctgattgtgcataattaaggagg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5170363 |
ttccccctgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgctgattgtgcataattaaggagg |
5170264 |
T |
 |
| Q |
110 |
tggcatgctgacgtggc |
126 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
5170263 |
tggcatgctgacgtggc |
5170247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 16312714 - 16312840
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgctgattgtgca-ta |
99 |
Q |
| |
|
|||||||||| |||||||||| || ||||||| ||||| ||| |||| | ||| |||||||||||||| |||||||||||||||||| |||| | || |
|
|
| T |
16312714 |
cttggagattcccccctgtaatataaagattccttggtgtacccccctaatgtcatctgactggattaatgagatgatgtggcacgctgactgtgtacta |
16312813 |
T |
 |
| Q |
100 |
attaaggaggtggcatgctgacgtggc |
126 |
Q |
| |
|
||||| ||||||||| ||||||||||| |
|
|
| T |
16312814 |
attaaagaggtggcacgctgacgtggc |
16312840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 1997044 - 1996954
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgctgat |
91 |
Q |
| |
|
|||||||||| |||| ||||||||| |||||||||||||||| ||||||| |||| ||| ||||| ||| | | ||||||| ||||||| |
|
|
| T |
1997044 |
cttggagattcccccttgtaaaatgtagattctttggtttacaccccccagtccatttgattggataaattagcttatgtggcgcgctgat |
1996954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 45 - 91
Target Start/End: Complemental strand, 47378674 - 47378628
Alignment:
| Q |
45 |
cccccaaaccatatgactggattaatgggatgatgtggcacgctgat |
91 |
Q |
| |
|
||||||| | ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47378674 |
cccccaagctatatgactggattaatgagatgatgtggcacgctgat |
47378628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 1995935 - 1995981
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgcccc |
47 |
Q |
| |
|
|||||||||| |||| ||||||||| |||||||||||||||| |||| |
|
|
| T |
1995935 |
cttggagattcccccttgtaaaatgtagattctttggtttacccccc |
1995981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 16314188 - 16314094
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgctgattgtg |
95 |
Q |
| |
|
|||||||||| |||| |||||||| |||||||||||||| || |||| | ||| ||||||||| | || ||||||||||| |||||||||| |
|
|
| T |
16314188 |
cttggagattcccccttgtaaaataaagattctttggttcacccccctaaggtcatctgactggataactgagatgatgtggcttgctgattgtg |
16314094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 25 - 91
Target Start/End: Original strand, 47862024 - 47862089
Alignment:
| Q |
25 |
gaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgctgat |
91 |
Q |
| |
|
|||||||||||||||||| || || ||||||| ||| |||||||||| | |||| |||||||||||| |
|
|
| T |
47862024 |
gaagattctttggtttacacctcc-aaaccatctgattggattaatgtggtgatttggcacgctgat |
47862089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 111; Significance: 6e-56; HSPs: 11)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 39605646 - 39605772
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgctgattgtgca-ta |
99 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
39605646 |
cttggagattcccccctgtaaaatgaagattctttggtttacaccccccaaaccatatgactggattaatgggatgatgtggcacgctgattgtgcatta |
39605745 |
T |
 |
| Q |
100 |
attaaggaggtggcatgctgacgtggc |
126 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
39605746 |
attaaggaggtggcatgctgacgtggc |
39605772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 54672697 - 54672819
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgctgattgtgca-ta |
99 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||| ||||| ||| | |||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
54672697 |
cttggagatttccca-tataaaatgaagattctttgatttacaccctc-aaaccatatgactggattaatgggatgatgtggcacgctgattgtgcacta |
54672794 |
T |
 |
| Q |
100 |
attaaggaggtggcatgctgacgtg |
124 |
Q |
| |
|
||||||||||| ||||||||||||| |
|
|
| T |
54672795 |
attaaggaggttgcatgctgacgtg |
54672819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 36437281 - 36437407
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgctgattgtgca-ta |
99 |
Q |
| |
|
|||||||||| |||||||||| || ||||||| ||||| || |||| | | | |||||||||||||| |||||||||||||||||| |||| | || |
|
|
| T |
36437281 |
cttggagattcccccctgtaatataaagattccttggtgtatccccctaatgtcttctgactggattaatgagatgatgtggcacgctgactgtgtacta |
36437380 |
T |
 |
| Q |
100 |
attaaggaggtggcatgctgacgtggc |
126 |
Q |
| |
|
||||| ||||||||| ||||||||||| |
|
|
| T |
36437381 |
attaaagaggtggcacgctgacgtggc |
36437407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 34799932 - 34800026
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgctgattgtg |
95 |
Q |
| |
|
|||||||||| |||| || ||||||||||||||||||||||| |||| | |||| ||||||||| |||| ||||| ||||| |||||||||| |
|
|
| T |
34799932 |
cttggagattcccccttgcaaaatgaagattctttggtttacccccctaaggccatctgactggataaatgagatgacgtggcttgctgattgtg |
34800026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 11 - 90
Target Start/End: Original strand, 34825662 - 34825741
Alignment:
| Q |
11 |
tccccctgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgctga |
90 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||| | ||| |||||||||||||| | |||||||||||||||| |
|
|
| T |
34825662 |
tccccttgtaaaatgaaaattctttggtttacacccctgatgtcatttgactggattaatgagctgatgtggcacgctga |
34825741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 36438760 - 36438666
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgctgattgtg |
95 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| || |||| | ||| ||||||||| | || ||||||||||| |||||||||| |
|
|
| T |
36438760 |
cttggagattcccccctgtaaaataaagattctttggttcacccccctaaggtcatctgactggataactgagatgatgtggcttgctgattgtg |
36438666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 37085479 - 37085525
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgcccc |
47 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
37085479 |
cttggagattcccccctgtaaaataaagattctttggtttacccccc |
37085525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 37086728 - 37086682
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgcccc |
47 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
37086728 |
cttggagattcccccctgtaaaataaagattctttggtttacccccc |
37086682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 48165571 - 48165612
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttac |
42 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
48165571 |
cttggagatttccccctgtaaaataaagattatttggtttac |
48165612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 34801378 - 34801332
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgcccc |
47 |
Q |
| |
|
|||||||||| |||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
34801378 |
cttggagattcccccttgtaaaataaagattctttggtttacccccc |
34801332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 10 - 42
Target Start/End: Complemental strand, 9239112 - 9239080
Alignment:
| Q |
10 |
ttccccctgtaaaatgaagattctttggtttac |
42 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
9239112 |
ttccccctgtaaaatgaagattatttggtttac |
9239080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 91; Significance: 5e-44; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 38973819 - 38973944
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgctgattgtgca-ta |
99 |
Q |
| |
|
|||||||||| | ||| ||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||||||||||||||||||||||| || |
|
|
| T |
38973819 |
cttggagatt-ctcccggtaaaatgaagattctttggtttacaccccccaaaccatatgactagattaataggatgatgtggcacgctgattgtgcatta |
38973917 |
T |
 |
| Q |
100 |
attaaggaggtggcatgctgacgtggc |
126 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
38973918 |
attaaggaggtggcatgctgacgtggc |
38973944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 39004917 - 39005042
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgctgattgtgca-ta |
99 |
Q |
| |
|
|||||||||| | ||| ||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||||||||||||||||||||||| || |
|
|
| T |
39004917 |
cttggagatt-ctcccggtaaaatgaagattctttggtttacaccccccaaaccatatgactagattaataggatgatgtggcacgctgattgtgcatta |
39005015 |
T |
 |
| Q |
100 |
attaaggaggtggcatgctgacgtggc |
126 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
39005016 |
attaaggaggtggcatgctgacgtggc |
39005042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 11 - 95
Target Start/End: Complemental strand, 26521978 - 26521894
Alignment:
| Q |
11 |
tccccctgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgctgattgtg |
95 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||| | ||| |||||||||||||| | |||||||||||||||| |||| |
|
|
| T |
26521978 |
tccccttgtaaaatgaagattctttggtttacacccctgatgtcatctgactggattaatgagctgatgtggcacgctgactgtg |
26521894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 45 - 91
Target Start/End: Complemental strand, 9310866 - 9310820
Alignment:
| Q |
45 |
cccccaaaccatatgactggattaatgggatgatgtggcacgctgat |
91 |
Q |
| |
|
||||||| | |||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
9310866 |
cccccaagctatatgaatggattaatgagatgatgtggcacgctgat |
9310820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 78; Significance: 3e-36; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 10 - 126
Target Start/End: Original strand, 13970025 - 13970140
Alignment:
| Q |
10 |
ttccccctgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgctgattgtgca-taattaaggag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13970025 |
ttccccctgtaaaatgaagattctttggtttatacccc-caaaccatatgactggattaatgagatgatgtggcacgctgattgtgcactaattaaggag |
13970123 |
T |
 |
| Q |
109 |
gtggcatgctgacgtggc |
126 |
Q |
| |
|
|| ||| ||||||||||| |
|
|
| T |
13970124 |
gttgca-gctgacgtggc |
13970140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 25 - 91
Target Start/End: Complemental strand, 9011020 - 9010955
Alignment:
| Q |
25 |
gaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgctgat |
91 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
9011020 |
gaagattctttggtttacaccccc-aaaccatctgactggattaatgtgatgatgtggcacgctgat |
9010955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 25 - 91
Target Start/End: Complemental strand, 17242066 - 17242001
Alignment:
| Q |
25 |
gaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgctgat |
91 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
17242066 |
gaagattctttggtttacaccccc-aaaccatctgactagattaatgtgatgatgtggcacgctgat |
17242001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 35712520 - 35712614
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgctgattgtg |
95 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||| |||| | ||| |||||||||||||| | ||||||| |||||||| |||| |
|
|
| T |
35712520 |
cttggagattcccccttgtaaaatgaagattctttggtttacacccctgatgtcatctgactggattaatgagctgatgtgacacgctgactgtg |
35712614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 35713682 - 35713636
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgcccc |
47 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||| |||| |
|
|
| T |
35713682 |
cttggagattcccccttgtaaaatgaagattctttggtttacacccc |
35713636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 47; Significance: 9e-18; HSPs: 7)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 5858965 - 5859091
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgctgattgtgca-ta |
99 |
Q |
| |
|
|||||||||| || ||||||| || ||||||| ||||| ||| |||| | ||| ||| |||||||||| |||||||||||||||||| |||||| || |
|
|
| T |
5858965 |
cttggagattccctcctgtaatataaagattccttggtgtacccccctaatgtcatctgattggattaatgagatgatgtggcacgctgactgtgcacta |
5859064 |
T |
 |
| Q |
100 |
attaaggaggtggcatgctgacgtggc |
126 |
Q |
| |
|
||||| ||||||||| ||||||||||| |
|
|
| T |
5859065 |
attaaagaggtggcaagctgacgtggc |
5859091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 2 - 87
Target Start/End: Original strand, 7538329 - 7538414
Alignment:
| Q |
2 |
ttggagatttccccctgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgc |
87 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| |||| | || | ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7538329 |
ttggagattccccctcgtaaaatgaagattctttgagttacccgcctaaggccatatgactggattaatgagatgatgtggcacgc |
7538414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 32146075 - 32146028
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgccccc |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
32146075 |
cttggagatttccccctgtaaaataaagattcattggtttacaccccc |
32146028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 2 - 83
Target Start/End: Complemental strand, 26545853 - 26545772
Alignment:
| Q |
2 |
ttggagatttccccctgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggc |
83 |
Q |
| |
|
||||||||| |||| |||||||| ||||||||||||||||| |||| | |||| ||||||||| |||| ||||| ||||| |
|
|
| T |
26545853 |
ttggagattcccccttgtaaaataaagattctttggtttacacccctaaggccatctgactggataaatgagatgacgtggc |
26545772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 21382549 - 21382595
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgcccc |
47 |
Q |
| |
|
|||||||||| |||| ||||||||| |||||||||||||||| |||| |
|
|
| T |
21382549 |
cttggagattcccccttgtaaaatgtagattctttggtttacccccc |
21382595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 21383807 - 21383761
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgcccc |
47 |
Q |
| |
|
|||||||||| |||| ||||||||| |||||||||||||||| |||| |
|
|
| T |
21383807 |
cttggagattcccccttgtaaaatgtagattctttggtttacacccc |
21383761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 10 - 48
Target Start/End: Original strand, 32145130 - 32145168
Alignment:
| Q |
10 |
ttccccctgtaaaatgaagattctttggtttacgccccc |
48 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
32145130 |
ttccccctgtaaaataaagattctttggtttacaccccc |
32145168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 25 - 91
Target Start/End: Original strand, 5737268 - 5737333
Alignment:
| Q |
25 |
gaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgctgat |
91 |
Q |
| |
|
|||||||||||||||||| |||| |||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
5737268 |
gaagattctttggtttacacccc-caaaccatctgactagattaatgtgatgatgtggcacgctgat |
5737333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 7849244 - 7849156
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgctga |
90 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||| ||| | ||| |||||||||||||| | |||| ||||||||||| |
|
|
| T |
7849244 |
cttggagatt-ccccttgtaaaatgaagattctttggtttacatccctgatgtcatctgactggattaatgagttgatatggcacgctga |
7849156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 23526754 - 23526713
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttac |
42 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
23526754 |
cttggagattcccccctataaaatgaagattctttggtttac |
23526713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 12 - 47
Target Start/End: Original strand, 23525666 - 23525701
Alignment:
| Q |
12 |
ccccctgtaaaatgaagattctttggtttacgcccc |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23525666 |
ccccctgtaaaatgaagattctttggtttacacccc |
23525701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 21262048 - 21262094
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgcccc |
47 |
Q |
| |
|
|||||||||| |||| ||||||||| |||||||||||||||| |||| |
|
|
| T |
21262048 |
cttggagattcccccttgtaaaatgtagattctttggtttacacccc |
21262094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 21263306 - 21263260
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgcccc |
47 |
Q |
| |
|
|||||||||| |||| ||||||||| |||||||||||||||| |||| |
|
|
| T |
21263306 |
cttggagattcccccttgtaaaatgtagattctttggtttacccccc |
21263260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 27491262 - 27491175
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgct |
88 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||||| |||| | |||| ||||||||| |||| | |||||||||||||| |
|
|
| T |
27491262 |
cttggagattccccattgtaaaatgaagattctttggtttacacccctgatgccatctgactggatcaatgagctgatgtggcacgct |
27491175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 6377017 - 6376935
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggc |
83 |
Q |
| |
|
|||||||||| || | ||||| | ||||||||||||||||| ||| | ||||||||||||||| |||||||||||||||| |
|
|
| T |
6377017 |
cttggagattccctcttgtaatttaaagattctttggtttacctccctaagaccatatgactggataaatgggatgatgtggc |
6376935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 27490168 - 27490214
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgcccc |
47 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||| |||| |
|
|
| T |
27490168 |
cttggagattcccccttgtaaaatgaagattctttggtttacacccc |
27490214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0061 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0061
Description:
Target: scaffold0061; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 9855 - 9936
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggc |
83 |
Q |
| |
|
|||||| ||| |||| |||||||| ||||||||||| ||||| |||| | ||||| |||||||||||||| ||||||||||| |
|
|
| T |
9855 |
cttggaaattcccccttgtaaaataaagattctttgatttac-cccctaagaccatctgactggattaatgagatgatgtggc |
9936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 17 - 95
Target Start/End: Complemental strand, 29043593 - 29043515
Alignment:
| Q |
17 |
tgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgctgattgtg |
95 |
Q |
| |
|
||||||||||||||| |||||||||| ||| | ||| |||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
29043593 |
tgtaaaatgaagattatttggtttacacccttgatgtcatctgactggattaatgagctgatgtggcacgctgattgtg |
29043515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 2 - 36
Target Start/End: Original strand, 41659560 - 41659594
Alignment:
| Q |
2 |
ttggagatttccccctgtaaaatgaagattctttg |
36 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41659560 |
ttggagattcccccctgtaaaatgaagattctttg |
41659594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 18775501 - 18775460
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttac |
42 |
Q |
| |
|
||||||||||| |||| ||||||| ||||||||||||||||| |
|
|
| T |
18775501 |
cttggagattttcccccgtaaaatcaagattctttggtttac |
18775460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 29042401 - 29042442
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttac |
42 |
Q |
| |
|
|||||||||| |||| || ||||||||||||||||||||||| |
|
|
| T |
29042401 |
cttggagattcccccttgaaaaatgaagattctttggtttac |
29042442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0197 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0197
Description:
Target: scaffold0197; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 28846 - 28967
Alignment:
| Q |
1 |
cttggagatttccccctgtaaaatgaagattctttggtttacgccccccaaaccatatgactggattaatgggatgatgtggcacgctgattgtgca-ta |
99 |
Q |
| |
|
|||||||||| |||||||||| || ||||||| ||||| ||| |||| | ||| |||||||||||||| |||||||| ||||| |||||| || |
|
|
| T |
28846 |
cttggagatt-ccccctgtaatataaagattccttggtgtacccccctaatgtcatctgactggattaatgagatgatgt----agctgactgtgcacta |
28940 |
T |
 |
| Q |
100 |
attaaggaggtggcatgctgacgtggc |
126 |
Q |
| |
|
||||| ||||||||| ||||||||||| |
|
|
| T |
28941 |
attaaagaggtggcacgctgacgtggc |
28967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0408 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0408
Description:
Target: scaffold0408; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 10155 - 10199
Alignment:
| Q |
4 |
ggagatttccccctgtaaaatgaagattctttggtttacgccccc |
48 |
Q |
| |
|
||||||| |||||| |||||| ||||||||||||||||| ||||| |
|
|
| T |
10155 |
ggagattcccccctataaaataaagattctttggtttaccccccc |
10199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University