View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0824_high_15 (Length: 232)
Name: NF0824_high_15
Description: NF0824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0824_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 32 - 181
Target Start/End: Complemental strand, 32811654 - 32811505
Alignment:
| Q |
32 |
attcttaattttctggctataaataaaaccacaaagaaaaataaaatatcttgcagagaagaagnnnnnnncatggcaaattttgttttgcaggttccaa |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32811654 |
attcttaattttctggctataaataaaaccacaaagaaaaataaaatatcttgcagagaagaagaaaaaaacatggcaaattttgttttgcaggttccaa |
32811555 |
T |
|
| Q |
132 |
atactttgaggagtttcgctgtatttgcttcatccaaccctaatggtgca |
181 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32811554 |
atactttgaggagtttcactgtatttgcttcatccaaccctaatggtgca |
32811505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5958 times since January 2019
Visitors: 5761