View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0824_low_2 (Length: 534)

Name: NF0824_low_2
Description: NF0824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0824_low_2
NF0824_low_2
[»] chr4 (1 HSPs)
chr4 (13-83)||(3420231-3420301)


Alignment Details
Target: chr4 (Bit Score: 63; Significance: 4e-27; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 13 - 83
Target Start/End: Original strand, 3420231 - 3420301
Alignment:
13 aatatctgaatatcatgaatatgcttttaaatttaatctttctttgcaacaaatgaaagactattaggaac 83  Q
    |||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||    
3420231 aatatctgaatatcatgaatatgcttttaaatttgatctttctttgaaacaaatgaaagactattaggaac 3420301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University