View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0824_low_22 (Length: 265)
Name: NF0824_low_22
Description: NF0824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0824_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 8 - 252
Target Start/End: Complemental strand, 27407 - 27163
Alignment:
| Q |
8 |
tattatcttctaagggtctgtatgaactccttggccatgaagaacaaccctccaatatggaatgggagatatcaaccatgatttgtctggcggagaaggc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27407 |
tattatcttctaagggtctgtatgaactccttggccatgaagaacaaccctccaatatggaatgggagatatcagccatgatttgtctggcggagaaggc |
27308 |
T |
|
| Q |
108 |
ctctaaaatcatcagcaggaaacctatagaaacctgcaaacagaatttagtcatccaagaaagttgacattatgattgttaagtatctaggaaaaaatga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27307 |
ctctaaaatcatcagcaggaaacctatagaaacctgcaaacagaatttagtcatccaaaaaagttgacattatgattgttaagtatctaggaaaaaatga |
27208 |
T |
|
| Q |
208 |
aatgacaattttcatctattttctttattttcatgtctgcactct |
252 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27207 |
aatgataattttcatctattttctttattttcatgtctgcactct |
27163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5694 times since January 2019
Visitors: 5758