View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0824_low_23 (Length: 251)
Name: NF0824_low_23
Description: NF0824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0824_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 11 - 208
Target Start/End: Original strand, 39187606 - 39187803
Alignment:
| Q |
11 |
cagagagacaaacaaaataaaccatgctctgacttcaacttgacatcatatgcacggtccagaacttgacaacgtattgcatagaagcgagaatgtacta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39187606 |
cagagagacaaacaaaataaaccatgctctgacttcaacttgacatcatatgcacggtccagaacttgacaatgtattgcatagaagcgagaatgtacta |
39187705 |
T |
 |
| Q |
111 |
catcatatgcatcgccttaatatccttacgcctgtgtataaattaaaagtaaattcattttacaacaagaagcaactgcttgttcatgtaaaactcgg |
208 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39187706 |
catcatatgcatcgccttaatatccatacgcctgtgtatagattaaaagtaaattcattttacaacaagaagcaactccttgttcatgtaaaactcgg |
39187803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University