View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0824_low_30 (Length: 209)
Name: NF0824_low_30
Description: NF0824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0824_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 22 - 85
Target Start/End: Complemental strand, 3340770 - 3340707
Alignment:
| Q |
22 |
gattatactgattgtgatttcaatacctccatagctctctcctcctatgtacaatgcccttgtt |
85 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3340770 |
gattattctgatggtgatttcaatacctccatagctctctcctcctatgtacaatgcccttgtt |
3340707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6509 times since January 2019
Visitors: 5768