View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0824_low_4 (Length: 533)
Name: NF0824_low_4
Description: NF0824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0824_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 63; Significance: 4e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 13 - 83
Target Start/End: Original strand, 3420231 - 3420301
Alignment:
Q |
13 |
aatatctgaatatcatgaatatgcttttaaatttaatctttctttgcaacaaatgaaagactattaggaac |
83 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
T |
3420231 |
aatatctgaatatcatgaatatgcttttaaatttgatctttctttgaaacaaatgaaagactattaggaac |
3420301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4722 times since January 2019
Visitors: 5752