View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0824_low_7 (Length: 405)
Name: NF0824_low_7
Description: NF0824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0824_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 53; Significance: 3e-21; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 7872546 - 7872494
Alignment:
| Q |
102 |
aggacaataaataaaaaagtcacacattgatctcatcacacgtctgaatcgga |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7872546 |
aggacaataaataaaaaagtcacacattgatctcatcacacgtctgaatcgga |
7872494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 233 - 271
Target Start/End: Complemental strand, 7872422 - 7872384
Alignment:
| Q |
233 |
aaccctaaccatggctactttcacctccttctctgctcc |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7872422 |
aaccctaaccatggctactttcacctccttctcttctcc |
7872384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University