View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0825-Insertion-11 (Length: 246)
Name: NF0825-Insertion-11
Description: NF0825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0825-Insertion-11 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 11 - 246
Target Start/End: Original strand, 50248373 - 50248608
Alignment:
| Q |
11 |
gtgttgctctgctccatggcttccatttccggatctcaatctggaggcaaaatggtccgcctccgccgtaccgccgtcgccagaaaccgcactccgtact |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50248373 |
gtgttgctctgctccatggcttccatttccggatctcaatctggaggcaaaatggtccgcctccgccgtaccgccgtcgccagaaaccgcactccgtact |
50248472 |
T |
|
| Q |
111 |
cccgaccctctccaccacaacctcatccggaaagccccaattggctttcacgtttcgtcatctctcctactcgtttcattgcttctggtgccggaaagat |
210 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50248473 |
cccgaccctctccaccacaacctcagctggaaagccccaattggctttcacgtttcgtcatctctcctactcgtttcattgcttctggtgccggaaagat |
50248572 |
T |
|
| Q |
211 |
tctcacttctgttttggatcttgaatcttcccctgc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
50248573 |
tctcacttctgttttggatcttgaatcttcccctgc |
50248608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 170 - 241
Target Start/End: Complemental strand, 9036357 - 9036286
Alignment:
| Q |
170 |
atctctcctactcgtttcattgcttctggtgccggaaagattctcacttctgttttggatcttgaatcttcc |
241 |
Q |
| |
|
|||||||| ||| ||||||||||||||| |||| |||||| | | || |||||||||||||||||||||||| |
|
|
| T |
9036357 |
atctctcccactagtttcattgcttctgatgccagaaagagtttgacctctgttttggatcttgaatcttcc |
9036286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5739 times since January 2019
Visitors: 5758