View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0825-Insertion-13 (Length: 257)
Name: NF0825-Insertion-13
Description: NF0825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0825-Insertion-13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 7 - 234
Target Start/End: Complemental strand, 13567645 - 13567418
Alignment:
| Q |
7 |
acatcacgcttccggtatctcctcttattgatagccgtatttagattcactctccggacgggggtctgtcagctaagcaagcctttcatcacttgcatcg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13567645 |
acatcacgcttccggtatctcctcttattgatagccgtatttagattcactctccggacgggggtctgtcaactaagcaagcctttcatcacttgcatcg |
13567546 |
T |
 |
| Q |
107 |
ccctcttcgtccattgcagtgggcttctactatctagaggtcttgtatccctccttctcactctattgttttatggcgtttaatgcatcgtaagctttcc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13567545 |
ccctcttcgtccattgcagtgggcttctactatccagaggtcttgtatccctccttctcactctattattttatggcgtttaatgcatcgtaagctttcc |
13567446 |
T |
 |
| Q |
207 |
ttcaatgataatttgaagatttgtgggt |
234 |
Q |
| |
|
| |||||||||||||||||||||||||| |
|
|
| T |
13567445 |
tccaatgataatttgaagatttgtgggt |
13567418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 12 - 163
Target Start/End: Complemental strand, 24968593 - 24968442
Alignment:
| Q |
12 |
acgcttccggtatctcctcttattgatagccgtatttagattcactctccggacgggggtctgtcagctaagcaagcctttcatcacttgcatcgccctc |
111 |
Q |
| |
|
||||||| |||| ||||||||||||||| ||| ||| |||||| ||| | ||| ||| | |||| |||||||||| ||||| |||| ||| ||| || |
|
|
| T |
24968593 |
acgcttctggtaactcctcttattgataagcgtgtttggattcattctacagactgggatgtgtctgctaagcaagattttcagtacttacattgccatc |
24968494 |
T |
 |
| Q |
112 |
ttcgtccattgcagtgggcttctactatctagaggtcttgtatccctccttc |
163 |
Q |
| |
|
|| ||||||| || ||| ||| |||||| ||||||||||||||||||||| |
|
|
| T |
24968493 |
ctcctccattgtggtaggcgtcttctatctggaggtcttgtatccctccttc |
24968442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University