View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0825-Insertion-15 (Length: 172)
Name: NF0825-Insertion-15
Description: NF0825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0825-Insertion-15 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 9e-84; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 9e-84
Query Start/End: Original strand, 8 - 172
Target Start/End: Complemental strand, 49461412 - 49461248
Alignment:
| Q |
8 |
aaaaatgtatctgcatctttatttgaaaatccggagctcatgcatgattatagattctgggcaataatttattctcttgttggacttgggaatgtaagtt |
107 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49461412 |
aaaaatgtatctgcatttttatttgaaaatccagagctcatgcatgattatagattctgggcaataatttattctcttgttggacttgggaatgtaagtt |
49461313 |
T |
|
| Q |
108 |
tttgactataaaacttttaagaaagtcgctagaaatatcaacaacttaccaaacatttttgtgag |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49461312 |
tttgactataaaacttttaagaaagtcgctagaaatatcaacaacttaccaaacatttttgtgag |
49461248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 122 - 166
Target Start/End: Complemental strand, 42175396 - 42175352
Alignment:
| Q |
122 |
ttttaagaaagtcgctagaaatatcaacaacttaccaaacatttt |
166 |
Q |
| |
|
||||||| |||| |||||||||||||| ||||| ||||||||||| |
|
|
| T |
42175396 |
ttttaaggaagttgctagaaatatcaataacttcccaaacatttt |
42175352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5340 times since January 2019
Visitors: 5756