View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0825-Insertion-16 (Length: 89)
Name: NF0825-Insertion-16
Description: NF0825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0825-Insertion-16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 48; Significance: 5e-19; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 5e-19
Query Start/End: Original strand, 8 - 67
Target Start/End: Complemental strand, 1513878 - 1513819
Alignment:
Q |
8 |
gtgttacacactaatttcttttgcaatcccgatttcgttcctgcgttgggttcaatgggt |
67 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||| ||||||||||| ||||| |
|
|
T |
1513878 |
gtgttacacactaatttcttttgcaatcctgatttcgttcctccgttgggttcactgggt |
1513819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University