View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0825-Insertion-18 (Length: 80)
Name: NF0825-Insertion-18
Description: NF0825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0825-Insertion-18 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 71; Significance: 8e-33; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 8e-33
Query Start/End: Original strand, 10 - 80
Target Start/End: Original strand, 40326725 - 40326795
Alignment:
Q |
10 |
taccgttgcaaattatccccgccaaacaacatgtaccagcagatgctatctgtggtttgttttgccattgc |
80 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40326725 |
taccgttgcaaattatccccgccaaacaacatgtaccagcagatgctatctgtggtttgttttgccattgc |
40326795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University