View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0825-Insertion-9 (Length: 462)
Name: NF0825-Insertion-9
Description: NF0825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0825-Insertion-9 |
 |  |
|
[»] scaffold0164 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0164 (Bit Score: 402; Significance: 0; HSPs: 1)
Name: scaffold0164
Description:
Target: scaffold0164; HSP #1
Raw Score: 402; E-Value: 0
Query Start/End: Original strand, 9 - 462
Target Start/End: Complemental strand, 2468 - 2018
Alignment:
Q |
9 |
cttcgccggagaggatttgagcgaaggatttgctcgtaactttcgatttcattgtttgttctaagggtttttccatcgctgaatcaagattcaccatgaa |
108 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2468 |
cttcgccggagaggatttgagtgaaggatttgctcgtaactttcgatttcattgtttgttctaagggtttttccatcgctgaatcaagattcaccatgaa |
2369 |
T |
 |
Q |
109 |
cggccatggacaaaccatggtgaagctttaaaggtccacgccggaaaggtgacctcaagaagagagattgaacccaggataattcaaacaaagaaggtac |
208 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
T |
2368 |
cggccatggacaaaccatggtgaagctttaaaggtcctcgccggaaaggtgacctcaagaagagagattgaacccaagataattcaaacaaagaagatac |
2269 |
T |
 |
Q |
209 |
acgaaagcaaccgtatagaggagaaagggtggcttcgccgccgtgcgcgtgagtggaataactgtaagaaatgagatatagttatggtaagagtaaaacc |
308 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
T |
2268 |
acgaaagcaaccgtatagaggagaaagggtggcttcgccgccgtgcgcgtgagtggaataaccgtaagaaatgacatatagttatggtaagagtaaaacc |
2169 |
T |
 |
Q |
309 |
ggagcctggccggagagggtttattttgccggatagaaacggttaccggtgacattttgagagagagagttttagaaaatttca-ttttttccccccaaa |
407 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
T |
2168 |
ggagcctggccggagagggtttattctgccggatagaaacggttaccggtgacattttgag----agagttttagaaaatttcatttttttccccccaaa |
2073 |
T |
 |
Q |
408 |
ctacataatacacacaggattcatcctctctaaagctatggttatggctgcagag |
462 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2072 |
ctacataatacacacaggattcatcctctctaaagctatggttatggctgcagag |
2018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University