View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0825_high_6 (Length: 395)
Name: NF0825_high_6
Description: NF0825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0825_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 23 - 390
Target Start/End: Original strand, 41445525 - 41445892
Alignment:
| Q |
23 |
caaaatcttctcacaagaaattgggaactccttcatcttcttttcgttggtattgctatctcttacggcttgttcagtcgtagaaaccaagaaccagaca |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
41445525 |
caaaatcttctcacaagaaattgggaactccttcatcttcttttcgttggtattgctatctcttacggcttgttcagccgtaggaaccaagaaccagaca |
41445624 |
T |
|
| Q |
123 |
aagacaccaataataacacaaagtttgataatgcacaatcacttgtctctcggttcttgcaagtttcgtcgcttttcgaagatgaagttgatcatcaaaa |
222 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |||| ||||||||||||||||||||||| |
|
|
| T |
41445625 |
aagacaacaataataacacaaagtttgataatgcacaatcacttgtttctcggttcttgcaagtttcatcgttttttgaagatgaagttgatcatcaaaa |
41445724 |
T |
|
| Q |
223 |
ccaatctgagtctgaagatattaacaaaatccaagcatggagtaatcaaaatcaacactatagaaataaacccatggttgttgttgctcctcaagtgcag |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
41445725 |
ccaatctgagtctgaagatattaacaaaatccaaacatggagtaatcaaaatcaacactacagaaataaacccatggttattgttgctcctcaagtacag |
41445824 |
T |
|
| Q |
323 |
caactacaaaactctgtttttgaagatgaacagagtagtttcaatgaaaatgaaaagcctttgcttct |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41445825 |
caactacaaaactctgtttttgaagatgaacagagtagtttcaatgaaaatgaaaagcctttgcttct |
41445892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6278 times since January 2019
Visitors: 5764