View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0825_low_17 (Length: 351)
Name: NF0825_low_17
Description: NF0825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0825_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 29 - 79
Target Start/End: Original strand, 26328140 - 26328190
Alignment:
| Q |
29 |
acaaatgataatctttcaagtttcttataggtaaatagagaattaactatc |
79 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
26328140 |
acaaatgataatctttcaggtttcttatagataaatagagaattaactatc |
26328190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 233 - 272
Target Start/End: Original strand, 26328346 - 26328385
Alignment:
| Q |
233 |
tttgattggagtatactaatactatgaactagcaacagct |
272 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26328346 |
tttgattggagtatactgatactatgaactagcaacagct |
26328385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 149 - 178
Target Start/End: Original strand, 26328262 - 26328291
Alignment:
| Q |
149 |
acttgtaaacatgtgaaagcaatgctccat |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26328262 |
acttgtaaacatgtgaaagcaatgctccat |
26328291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5516 times since January 2019
Visitors: 5757