View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0825_low_20 (Length: 324)
Name: NF0825_low_20
Description: NF0825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0825_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 16 - 295
Target Start/End: Original strand, 51705003 - 51705282
Alignment:
Q |
16 |
atagacacacaagcaagttaattgagtgtatgaagaaaaatgagtcacgttgaaagtggagcgaagttattggctacactagcacttgctctctttcatc |
115 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51705003 |
atagacacacaagcaagttaattgagtgtatgaagaaaaatgagtcaagttgaaactggagcgaagttattggctacactagcacttgctctctttcatc |
51705102 |
T |
 |
Q |
116 |
ttcttccagtaaaccctacattgtccgaatttaaccgtcaccgtgaaattacattgttagaggaacacttaactgctgcggaaaccactgttagagtggt |
215 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
51705103 |
ttcttccagtaacccctacattgtccgaatttaaccgtcaccgtgaaattacattgttagaggaacacttaactgctgcggaaaccaccgttagagtggt |
51705202 |
T |
 |
Q |
216 |
cagagttcggaaagacggaaccggagattttacgacggtgacggatgccgttaaaagcattccgtcaggaaacaaaagga |
295 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51705203 |
cagagttcggaaagacggaaccggagattttacgacggtgacggatgccgttaaaagcattccgtcaggaaacaaaagga |
51705282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University