View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0825_low_25 (Length: 291)
Name: NF0825_low_25
Description: NF0825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0825_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 289
Target Start/End: Original strand, 42551139 - 42551432
Alignment:
Q |
1 |
tcttcgtgggaatgatttgaacccgcttgatgaacatgagcttaggtcatctcggaggtagtctttgagcaacagctagggctttgaggtatatttggtt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
T |
42551139 |
tcttcgtgggaatgatttgaacccgcttgatgaacatgagcttaggtcatctcggaggtagtctttgagcaaaagggtaggctttgaggtatatttggtt |
42551238 |
T |
 |
Q |
101 |
ggttttattattagagaattatcacgacgtgaaggtttgcaaatatttgaagccatgtatagaac----aaagtagctttgctatatgaatatttcaaga |
196 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
T |
42551239 |
ggttttattattagagaattatcacgacgtgaaggtttgcaaatatttgaagccatgtatagaacaattaaagtagatttgctatatgaatatttcaaga |
42551338 |
T |
 |
Q |
197 |
gaatacactcataagaaaattgatgaactatggagaaaag-ttgtatggtgcagaagtttagatataagcaacatttatatattgttggagatg |
289 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42551339 |
gaatacactcataagaaaattgatgaactatggagaaaagagtgtatggtgcagaagtttagatataagcaacatttatatattgttggagatg |
42551432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5009 times since January 2019
Visitors: 5753