View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0825_low_26 (Length: 286)
Name: NF0825_low_26
Description: NF0825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0825_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 47 - 240
Target Start/End: Original strand, 29095697 - 29095891
Alignment:
| Q |
47 |
atgaaaacatgaactgaaaacagaaaatgttctataataccaaagagaccctaatgtctctaaaaattgttgagatgacattatttttctcctctagggt |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29095697 |
atgaaaacatgaactgaaaacagaaaatgttctataataccaaagagaccctaatgtctctaaaaattgttgagatgacattatttttctcttctagggt |
29095796 |
T |
|
| Q |
147 |
tgagggt-gatgattaaattggcagtcgttgacacattgattgtggtttgacgaatcaggtggctaaggagcaggcagagaggagggcaacagct |
240 |
Q |
| |
|
||||||| ||| ||||||||||| |||||||||||| | |||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29095797 |
tgagggtatatggttaaattggcactcgttgacacatagtttgtggtttgacaaatcaggtggctaaggagcaggcagagaggagggcaacagct |
29095891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5042 times since January 2019
Visitors: 5753