View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0825_low_35 (Length: 265)
Name: NF0825_low_35
Description: NF0825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0825_low_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 25 - 225
Target Start/End: Original strand, 40763671 - 40763871
Alignment:
| Q |
25 |
gctgttgctcggattgggaatgctcttgcttatgctacacatgcatttttcaacaagcatgggtttctttatgtgcgcacgccaattgtcacgacaagtg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40763671 |
gctgttgctcggattgggaatgctcttgcttatgctacacatacatttttcaacaagcatgggtttctttatgtgcgcacgccaattgtcacgacaagtg |
40763770 |
T |
|
| Q |
125 |
attgtgagggtgctggtgaaatgtttcaagtgacaactctgttcagtgaagcagagaggttggagaaggaactgatacagaatcctcctcctactgaatc |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40763771 |
attgtgagggtgctggtgaaatgtttcaagtgacaactctgttcagtgaagcagagaggttggagaaggaactgatacagaatcctcctcctactgaatc |
40763870 |
T |
|
| Q |
225 |
t |
225 |
Q |
| |
|
| |
|
|
| T |
40763871 |
t |
40763871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 172 - 225
Target Start/End: Original strand, 40763938 - 40763991
Alignment:
| Q |
172 |
gaagcagagaggttggagaaggaactgatacagaatcctcctcctactgaatct |
225 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40763938 |
gaagcagaaaggttggagaaggaacagatacagaatcctcctcctactgaatct |
40763991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 25 - 222
Target Start/End: Original strand, 42911399 - 42911596
Alignment:
| Q |
25 |
gctgttgctcggattgggaatgctcttgcttatgctacacatgcatttttcaacaagcatgggtttctttatgtgcgcacgccaattgtcacgacaagtg |
124 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
42911399 |
gctgttgctcggattcggaatgctcttgcttatgctacacatacatttttcaacaagcatgggtttctttatgtgcacacgccaattgtcacgactagtg |
42911498 |
T |
|
| Q |
125 |
attgtgagggtgctggtgaaatgtttcaagtgacaactctgttcagtgaagcagagaggttggagaaggaactgatacagaatcctcctcctactgaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42911499 |
attgtgagggtgctggtgaaatgtttcaagtgacaactttgttcagtgaagcagagaggttggagaaggaactgatacagaatcctcctccaactgaa |
42911596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6620 times since January 2019
Visitors: 5769