View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0825_low_36 (Length: 252)
Name: NF0825_low_36
Description: NF0825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0825_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 28532596 - 28532371
Alignment:
| Q |
1 |
atcacaagactttgcttgctatttgaatcaaccgcacgacgacctgtcaagagttcaagtaacaataccccaaatgcaaaaacatcagtcttctcatcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28532596 |
atcacaagactttgcttgctatttgaatcaaccgcacgacgacctgtcaagagttcaagtaacaataccccaaatgcaaaaacatcagtcttctcatcca |
28532497 |
T |
 |
| Q |
101 |
caagtccatgcatgaaatactctggagccaaatacctgcaacaaaattaccaaccatagtttcttaaatagaatttacacatacaagaaaatgcataa-a |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
28532496 |
caagtccatgcatgaaatactctggagccaaatacctgcaacaaaattaccaaccatagtttcttaaatagaatttacacatacaagaaaatgcataaaa |
28532397 |
T |
 |
| Q |
200 |
aaatcatttgattttatgctaatgcg |
225 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
28532396 |
aaatcatttgattttatgctaatgcg |
28532371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 13673618 - 13673482
Alignment:
| Q |
1 |
atcacaagactttgcttgctatttgaatcaaccgcacgacgacctgtcaagagttcaagtaacaataccccaaatgcaaaaacatcagtcttctcatcca |
100 |
Q |
| |
|
||||||||||||||||| |||| |||||||| |||||||||||||| | |||||| |||| || || || ||||| || ||||| ||||||||||||| |
|
|
| T |
13673618 |
atcacaagactttgcttactatcggaatcaactgcacgacgacctgttatgagttcgagtagtaaaacgccgaatgcgaatacatctgtcttctcatcca |
13673519 |
T |
 |
| Q |
101 |
caagtccatgcatgaaatactctggagccaaatacct |
137 |
Q |
| |
|
||| |||||||| || |||||||||||||||||||| |
|
|
| T |
13673518 |
caacaccatgcataaagtactctggagccaaatacct |
13673482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University