View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0825_low_38 (Length: 251)
Name: NF0825_low_38
Description: NF0825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0825_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 13 - 237
Target Start/End: Complemental strand, 37319775 - 37319551
Alignment:
| Q |
13 |
tcagaatttcttttactttatttcttttctaagatttcaatatcctatttaaatatgtccataacaaattttacttgtaactgtattcatattattgatc |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37319775 |
tcaggatttcttttactttatttcttttctaagatttcaatatcctatttaaatatgtccataacaaattttacttgtaaccgtattcatattattgatc |
37319676 |
T |
 |
| Q |
113 |
aatcaggatggctatttttagaatttcatagatttctgtaatgaagtaatatattttaattttctacaacaaatctatcatttgtctcttattttgtcaa |
212 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37319675 |
aatcagcattgctatttttagaatttcatagatttctgtaatgaagtaatatattttaattttctacaacaaatctatcatttgtctcttattttgtcaa |
37319576 |
T |
 |
| Q |
213 |
ataatgaaataattgcacacaggtt |
237 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
37319575 |
ataatgaaataattgcacacaggtt |
37319551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University