View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0825_low_41 (Length: 251)
Name: NF0825_low_41
Description: NF0825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0825_low_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 16 - 137
Target Start/End: Complemental strand, 28533127 - 28533006
Alignment:
Q |
16 |
atgcagacaaagaacacatgatggttgatcacatagtttggccgattgtgtctacctctcaaacttttaatcgaacttgagaatttacattgtacagatt |
115 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
28533127 |
atgcagacaaagaacacatgatggttgatcacatagtttggccgattgtgtctacctctcaaacttttaatcgaacttaggaatttacattgtacagatt |
28533028 |
T |
 |
Q |
116 |
gcatttacaatattatccctga |
137 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
28533027 |
gcatttacaatattatccctga |
28533006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 139 - 251
Target Start/End: Complemental strand, 28532967 - 28532855
Alignment:
Q |
139 |
cacatgtgaatgcaaagaccaaagtgnnnnnnnnnnnntatgcttattttgttacctggtccatgaatggtcttttagaggacatgtggtggatacatct |
238 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
28532967 |
cacatgtgaatgcaaagaccaaagtgaaaaagaaaaaatatgcttattttgttacctggtccatgaatggtctttttgaggacatgtggtggatacatct |
28532868 |
T |
 |
Q |
239 |
ggaagctgttgcc |
251 |
Q |
|
|
||||||||||||| |
|
|
T |
28532867 |
ggaagctgttgcc |
28532855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University