View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0825_low_48 (Length: 231)
Name: NF0825_low_48
Description: NF0825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0825_low_48 |
 |  |
|
[»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 11 - 231
Target Start/End: Original strand, 32641042 - 32641262
Alignment:
Q |
11 |
atgataccctccctacgatcctcagagtgatcttattgagatcctgcaaacaacgtggtttggctagtgggtactgaagaaaaccgggctatagtttcac |
110 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
32641042 |
atgataccctccctacgatcctcaaagtgatcttattgagatcctgcaaacaacgtggtttggctagtcggtactgaagaaaaccgggctatagtttcac |
32641141 |
T |
 |
Q |
111 |
cctatctgcttcgtacatctctaccatatggaaacacgtaacataggtggttgtagaccatatctcgcttttttcctagattgggagattgcaacccgaa |
210 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32641142 |
cctatctgcttcgtacatctctaccacatggaaacacgtaacataggtggttgtagaccatatctcgcttttttcctagattgggagattgcaacccgaa |
32641241 |
T |
 |
Q |
211 |
ataagacctccacttgaacta |
231 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
32641242 |
ataagacctccacttgaacta |
32641262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University