View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0825_low_49 (Length: 219)

Name: NF0825_low_49
Description: NF0825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0825_low_49
NF0825_low_49
[»] chr7 (1 HSPs)
chr7 (1-43)||(32726632-32726674)


Alignment Details
Target: chr7 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 32726632 - 32726674
Alignment:
1 atttgtatcttgatatccatgtgttcagcaaagtttgactatc 43  Q
    |||||||||||||||||||||||||||||||||||||||||||    
32726632 atttgtatcttgatatccatgtgttcagcaaagtttgactatc 32726674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University