View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0825_low_49 (Length: 219)
Name: NF0825_low_49
Description: NF0825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0825_low_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 32726632 - 32726674
Alignment:
Q |
1 |
atttgtatcttgatatccatgtgttcagcaaagtttgactatc |
43 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32726632 |
atttgtatcttgatatccatgtgttcagcaaagtttgactatc |
32726674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6665 times since January 2019
Visitors: 5770