View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0825_low_50 (Length: 205)

Name: NF0825_low_50
Description: NF0825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0825_low_50
NF0825_low_50
[»] chr3 (1 HSPs)
chr3 (1-71)||(40809862-40809931)


Alignment Details
Target: chr3 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 40809931 - 40809862
Alignment:
1 agcatgttgttgttgtttcagcaaaggtcatagatgggaagaagagagtagttgagtgaggaggtatgtgg 71  Q
    |||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||    
40809931 agcatgttgttgttgtttcagcaa-ggtcagagatgggaagaagagagtagttgagtgaggaggtatgtgg 40809862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University