View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0825_low_51 (Length: 205)
Name: NF0825_low_51
Description: NF0825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0825_low_51 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 10230923 - 10231115
Alignment:
| Q |
1 |
cacgtggaaggaactgtgggtttggtccgtttcttatgtaagcaccgttaagtgacggcgggagtgtacctttgataatttgacattgtgttggagggag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
10230923 |
cacgtggaaggaactgtgggtttggtccgtttcttatgtaagcaccgtaaagtgacggcgggagtgtacctttgatgattacacattgtgttggagggag |
10231022 |
T |
|
| Q |
101 |
ttcgtcaaggactggtgcaaagttttgggacaaaacatgtcttggatctacggatggttttattggtgggtctatgaaggtgttgatgatgtc |
193 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10231023 |
ttcgtctaggactggtgcaaagttttgggacaaaacatgtcttggatctacggatggttttattggtgggtctatgaaggtgttgataatgtc |
10231115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 10254902 - 10254710
Alignment:
| Q |
1 |
cacgtggaaggaactgtgggtttggtccgtttcttatgtaagcaccgttaagtgacggcgggagtgtacctttgataatttgacattgtgttggagggag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| || ||||| ||||| || | || ||||||||||||||||| |
|
|
| T |
10254902 |
cacgtggaaggaactgtgggtttggtccgtttcttatgtaaacaccgttaagtgacggtggaagtgtgcctttaatgactttgcattgtgttggagggag |
10254803 |
T |
|
| Q |
101 |
ttcgtcaaggactggtgcaaagttttgggacaaaacatgtcttggatctacggatggttttattggtgggtctatgaaggtgttgatgatgtc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10254802 |
ttcgtcaaggactggtgcaaagttttgggacaaaacatgtcttggatctacggatggttttattggtgggtctatgaaggtgttgatgatgtc |
10254710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 10239703 - 10239895
Alignment:
| Q |
1 |
cacgtggaaggaactgtgggtttggtccgtttcttatgtaagcaccgttaagtgacggcgggagtgtacctttgataatttgacattgtgttggagggag |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| || ||||| ||||| || | || ||||||||||||||||| |
|
|
| T |
10239703 |
cacgtggaaggaactgagggtttggtccgtttcttatgtaaacaccgttaagtgacggtggaagtgtgcctttaatgactttgcattgtgttggagggag |
10239802 |
T |
|
| Q |
101 |
ttcgtcaaggactggtgcaaagttttgggacaaaacatgtcttggatctacggatggttttattggtgggtctatgaaggtgttgatgatgtc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10239803 |
ttcgtcaaggactggtgcaaagttttgggacaaaacatgtcttggatctacggatggttttattggtgggtctatgaaggtgttgatgatgtc |
10239895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5975 times since January 2019
Visitors: 5761