View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0826_high_4 (Length: 209)
Name: NF0826_high_4
Description: NF0826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0826_high_4 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 104 - 209
Target Start/End: Original strand, 4739278 - 4739383
Alignment:
Q |
104 |
gagataaagttgaagttgtggaaccatttttgtggagacaaaatgtcttcatgtggtgttaacttttgggttcaatcttaatttgtttaaatggcttata |
203 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | ||| |||| ||||||||| |
|
|
T |
4739278 |
gagataaagttgaagttgtggaaccatttttgtggagacaaaatgtcttcatgtggtgttaagttttgggttcaatcttcacttgcttaactggcttata |
4739377 |
T |
 |
Q |
204 |
tcttga |
209 |
Q |
|
|
|||||| |
|
|
T |
4739378 |
tcttga |
4739383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5258 times since January 2019
Visitors: 5755