View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0826_low_14 (Length: 209)

Name: NF0826_low_14
Description: NF0826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0826_low_14
NF0826_low_14
[»] chr4 (1 HSPs)
chr4 (104-209)||(4739278-4739383)


Alignment Details
Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 104 - 209
Target Start/End: Original strand, 4739278 - 4739383
Alignment:
104 gagataaagttgaagttgtggaaccatttttgtggagacaaaatgtcttcatgtggtgttaacttttgggttcaatcttaatttgtttaaatggcttata 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | ||| |||| |||||||||    
4739278 gagataaagttgaagttgtggaaccatttttgtggagacaaaatgtcttcatgtggtgttaagttttgggttcaatcttcacttgcttaactggcttata 4739377  T
204 tcttga 209  Q
    ||||||    
4739378 tcttga 4739383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University