View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0826_low_3 (Length: 477)
Name: NF0826_low_3
Description: NF0826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0826_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 3e-55; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 279 - 400
Target Start/End: Original strand, 25527879 - 25528000
Alignment:
| Q |
279 |
tggcgacagagtgacattgttgagtttgaaaccctaaaatttcgtactttctaatttgaaatgaaaatgaaatgaattcttctaacatctttcttcttat |
378 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25527879 |
tggcgaaagagtgacattgttgagtttgaaaccctaaaatttcgtactttctattttgaaatgaaaatgaaatgaattcttctaacatctttcttcttat |
25527978 |
T |
 |
| Q |
379 |
atatactacccccagcagaatt |
400 |
Q |
| |
|
|||||||||| ||||||||||| |
|
|
| T |
25527979 |
atatactaccaccagcagaatt |
25528000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 124 - 219
Target Start/End: Original strand, 25527724 - 25527819
Alignment:
| Q |
124 |
cagaggcagcgtcgaggttgccggagcgaatcaatgacgtgacacgcgtgtggagttcttcaggaggaggctggggctccgccgttgctgcttgtt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25527724 |
cagaggcagcgtcgaggttgccggagcgaatcaatgacgtgacacgcgtgtggagttcttcaggaggaggctgaggctccgccgttgctgcttgtt |
25527819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 124 - 212
Target Start/End: Original strand, 25535753 - 25535841
Alignment:
| Q |
124 |
cagaggcagcgtcgaggttgccggagcgaatcaatgacgtgacacgcgtgtggagttcttcaggaggaggctggggctccgccgttgct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25535753 |
cagaggcagcgtcgaggttgccggagcgaatcaacgatctgacgcgcgtgtggagttcttcaggaggaggctggggctccgccgttgct |
25535841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University