View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0826_low_5 (Length: 375)
Name: NF0826_low_5
Description: NF0826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0826_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 3e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 34 - 339
Target Start/End: Original strand, 51387291 - 51387587
Alignment:
| Q |
34 |
gtatattgtacacaaagtaacaagtatcattgagatgtactatcgatgcannnnnnnnnnnnnngtaagttgtaacagtgtcattgattttccccctnnn |
133 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51387291 |
gtatattgtacacaaggtaacaagtatcattgagatgtactatcgatgcatttttttttt----gtaagttgtaacagtgtcattgattttccccctaaa |
51387386 |
T |
 |
| Q |
134 |
nnnnncactatctttgatttttatattagcatgaaatgaaatgagaactcacatcaaaaaatataaaatcannnnnnnnncattcaatttagttttgata |
233 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
51387387 |
aaaaacactttctttgatttttatattagcatgaaatga-----gaactcacatcaaaaaatataaaatcatttttttttcattgaatttagttttgata |
51387481 |
T |
 |
| Q |
234 |
tatcaaagaataattacattttaaaaataacttttttgatgtcaagttcaaatcacnnnnnnnnacggcaaaacaaatcctcactaaatcactttataat |
333 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
51387482 |
tatcaaagaataattacattttgaaaataacttttttgatgtcaagttcaaatcacttttttttacggcaaaaccaatcctcactagatcactttataat |
51387581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University