View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0826_low_6 (Length: 335)
Name: NF0826_low_6
Description: NF0826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0826_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 109 - 259
Target Start/End: Complemental strand, 40326723 - 40326573
Alignment:
| Q |
109 |
gctgtatattgcaaatgcaggagactcaagggctgtgttaggaagagtgaggaggggaacaagggaaacattagctgttcagttatctacagaacacaat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40326723 |
gctgtatattgcaaatgcaggagactcaagggctgtgttaggaagagtgaggaggggaacaagggaaacattagccgttcagttatctacagaacacaat |
40326624 |
T |
|
| Q |
209 |
gttaatatagaaactgagagagatgatgttcggtcaaagcacccctatgat |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40326623 |
gttaatatagaaactgagagagatgatgttcggtcaaagcacccctatgat |
40326573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 113 - 213
Target Start/End: Complemental strand, 28938953 - 28938853
Alignment:
| Q |
113 |
tatattgcaaatgcaggagactcaagggctgtgttaggaagagtgaggaggggaacaagggaaacattagctgttcagttatctacagaacacaatgtta |
212 |
Q |
| |
|
|||||||||||| | || |||||||||| |||||||||||| | ||||| |||||||||||||| ||| | || |||||| ||||||| ||||||| |
|
|
| T |
28938953 |
tatattgcaaattctggtgactcaagggtggtgttaggaagactagagagggcaacaagggaaacatcagccatacaattatctgcagaacataatgtta |
28938854 |
T |
|
| Q |
213 |
a |
213 |
Q |
| |
|
| |
|
|
| T |
28938853 |
a |
28938853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5820 times since January 2019
Visitors: 5759