View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0826_low_7 (Length: 292)
Name: NF0826_low_7
Description: NF0826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0826_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 126 - 241
Target Start/End: Complemental strand, 49007622 - 49007507
Alignment:
| Q |
126 |
tatgtctaaacaaagtctttcgtatttattattgattaagctatcaataaatgagatacttcgataatattacccatggtgttccattgtggagagtttc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49007622 |
tatgtctaaacaaagtctttcgtatttattattgattaagctatcaataaatgagatacttcgataatattacccatggtgttccattgtggagagtttc |
49007523 |
T |
 |
| Q |
226 |
aagcactggttctctg |
241 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
49007522 |
aagcactggtcctctg |
49007507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 70 - 130
Target Start/End: Complemental strand, 49007735 - 49007671
Alignment:
| Q |
70 |
agcagcaactgttattaccta----agataaagttagttaattgttagtaaagggtgagttatgt |
130 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49007735 |
agcagcaactgttattacctattagagataaagttagttaattgttagtaaagggtgagttatgt |
49007671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University