View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0826_low_8 (Length: 286)

Name: NF0826_low_8
Description: NF0826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0826_low_8
NF0826_low_8
[»] chr2 (2 HSPs)
chr2 (26-109)||(3497094-3497177)
chr2 (136-258)||(3496944-3497068)
[»] chr4 (1 HSPs)
chr4 (26-91)||(35565919-35565984)
[»] chr8 (1 HSPs)
chr8 (149-190)||(43236102-43236143)


Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 26 - 109
Target Start/End: Complemental strand, 3497177 - 3497094
Alignment:
26 gttggagatgattggtgggatgttgtgggttgtacacagagagctgctgaagagggtattggtaagaatgtgcaaattattaag 109  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3497177 gttggagttgattggtgggatgttgtgggttgtacacagagagctgctgaagagggtattggtaagaatgtgcaaattattaag 3497094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 136 - 258
Target Start/End: Complemental strand, 3497068 - 3496944
Alignment:
136 atagaagtttgtgtttgggaaactagagatgcaaactatttagtcctgctgctata--nnnnnnnnnnnngggttttacttgaaatttatgccagnnnnn 233  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||              |||||||||||||||||||||||||         
3497068 atagaagtttgtgtttgggaaactagagatgcaaactatttagtcctgctgctatattttttttttttttgggttttacttgaaatttatgccagaaaaa 3496969  T
234 nnggacattacaatttactttattt 258  Q
      |||||||||||||||||||||||    
3496968 aaggacattacaatttactttattt 3496944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 26 - 91
Target Start/End: Complemental strand, 35565984 - 35565919
Alignment:
26 gttggagatgattggtgggatgttgtgggttgtacacagagagctgctgaagagggtattggtaag 91  Q
    ||||||| |||||||||||||| |||||| || || ||||| |||||||| || ||||||||||||    
35565984 gttggagttgattggtgggatgctgtgggctgcacccagagtgctgctgaggatggtattggtaag 35565919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 149 - 190
Target Start/End: Complemental strand, 43236143 - 43236102
Alignment:
149 tttgggaaactagagatgcaaactatttagtcctgctgctat 190  Q
    ||||||||| |||||||||||||||||||||| |||| ||||    
43236143 tttgggaaattagagatgcaaactatttagtcttgctactat 43236102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University