View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0826_low_8 (Length: 286)
Name: NF0826_low_8
Description: NF0826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0826_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 26 - 109
Target Start/End: Complemental strand, 3497177 - 3497094
Alignment:
| Q |
26 |
gttggagatgattggtgggatgttgtgggttgtacacagagagctgctgaagagggtattggtaagaatgtgcaaattattaag |
109 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3497177 |
gttggagttgattggtgggatgttgtgggttgtacacagagagctgctgaagagggtattggtaagaatgtgcaaattattaag |
3497094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 136 - 258
Target Start/End: Complemental strand, 3497068 - 3496944
Alignment:
| Q |
136 |
atagaagtttgtgtttgggaaactagagatgcaaactatttagtcctgctgctata--nnnnnnnnnnnngggttttacttgaaatttatgccagnnnnn |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3497068 |
atagaagtttgtgtttgggaaactagagatgcaaactatttagtcctgctgctatattttttttttttttgggttttacttgaaatttatgccagaaaaa |
3496969 |
T |
 |
| Q |
234 |
nnggacattacaatttactttattt |
258 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
3496968 |
aaggacattacaatttactttattt |
3496944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 26 - 91
Target Start/End: Complemental strand, 35565984 - 35565919
Alignment:
| Q |
26 |
gttggagatgattggtgggatgttgtgggttgtacacagagagctgctgaagagggtattggtaag |
91 |
Q |
| |
|
||||||| |||||||||||||| |||||| || || ||||| |||||||| || |||||||||||| |
|
|
| T |
35565984 |
gttggagttgattggtgggatgctgtgggctgcacccagagtgctgctgaggatggtattggtaag |
35565919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 149 - 190
Target Start/End: Complemental strand, 43236143 - 43236102
Alignment:
| Q |
149 |
tttgggaaactagagatgcaaactatttagtcctgctgctat |
190 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||| |||| |
|
|
| T |
43236143 |
tttgggaaattagagatgcaaactatttagtcttgctactat |
43236102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University