View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0827_high_11 (Length: 252)
Name: NF0827_high_11
Description: NF0827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0827_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 12 - 196
Target Start/End: Original strand, 45023635 - 45023829
Alignment:
| Q |
12 |
agagagagaaaagtgttaagaatcatagtcgagtttaacagaaaataataataataaaaaggagaattagtgtctcttattgtataa----------ata |
101 |
Q |
| |
|
|||||||||||||||||||||||||| ||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45023635 |
agagagagaaaagtgttaagaatcatgatcgtgtctaacagaaaataataataataaaaaggagaattagtgtctcttattgtataattgattgatgata |
45023734 |
T |
|
| Q |
102 |
atacgaagaagaagctacaacgattccaaagtaattaagaatattgagtttatgtccttcggctacaattgtaaaaagatgaatattcgcttgac |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45023735 |
gtacgaagaagaagctacaacgattccaaagtaattaagaatattaagtttatgtccttcggctacaattgtaaaaagatgaatattcgcttgac |
45023829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 212 - 252
Target Start/End: Original strand, 45023849 - 45023889
Alignment:
| Q |
212 |
tattagtgtcccttattagtaactctaatcaatatttattt |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45023849 |
tattagtgtcccttattagtaactctaatcaatatttattt |
45023889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 85 times since January 2019
Visitors: 5847