View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0827_high_11 (Length: 252)

Name: NF0827_high_11
Description: NF0827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0827_high_11
NF0827_high_11
[»] chr8 (2 HSPs)
chr8 (12-196)||(45023635-45023829)
chr8 (212-252)||(45023849-45023889)


Alignment Details
Target: chr8 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 12 - 196
Target Start/End: Original strand, 45023635 - 45023829
Alignment:
12 agagagagaaaagtgttaagaatcatagtcgagtttaacagaaaataataataataaaaaggagaattagtgtctcttattgtataa----------ata 101  Q
    ||||||||||||||||||||||||||  ||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||          |||    
45023635 agagagagaaaagtgttaagaatcatgatcgtgtctaacagaaaataataataataaaaaggagaattagtgtctcttattgtataattgattgatgata 45023734  T
102 atacgaagaagaagctacaacgattccaaagtaattaagaatattgagtttatgtccttcggctacaattgtaaaaagatgaatattcgcttgac 196  Q
     |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
45023735 gtacgaagaagaagctacaacgattccaaagtaattaagaatattaagtttatgtccttcggctacaattgtaaaaagatgaatattcgcttgac 45023829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 212 - 252
Target Start/End: Original strand, 45023849 - 45023889
Alignment:
212 tattagtgtcccttattagtaactctaatcaatatttattt 252  Q
    |||||||||||||||||||||||||||||||||||||||||    
45023849 tattagtgtcccttattagtaactctaatcaatatttattt 45023889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University