View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0827_low_8 (Length: 419)
Name: NF0827_low_8
Description: NF0827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0827_low_8 |
 | |
|
| [»] scaffold0402 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0402 (Bit Score: 173; Significance: 7e-93; HSPs: 1)
Name: scaffold0402
Description:
Target: scaffold0402; HSP #1
Raw Score: 173; E-Value: 7e-93
Query Start/End: Original strand, 99 - 342
Target Start/End: Original strand, 8463 - 8703
Alignment:
| Q |
99 |
cattctccttgccgcctccaaattccttcaacctgaaatcttcagctcnnnnnnnnnaatcccattacttccaagttgaactttcaatttatgttgcctc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8463 |
cattctccttgccgcctccaaattccttcaacctgaagtcttcagctctcttt----aatccccttacttccaagttgaactttcaatttatgttgcctc |
8558 |
T |
|
| Q |
199 |
tgatccgtacagacaaaacagctttttccccaagttgtttctttttgaggttgcttactatacccaccgcctcattcatttgtcttttgcgctgcctttt |
298 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
8559 |
tgatccgtacagacaaaacagcttttttcccaagttgtttctttttgaggttgcttactgtacccaccgcctcattcatttgtcttttgcgctgcctctt |
8658 |
T |
|
| Q |
299 |
ccttgatta-cttcacctgtatcattctcttgtgcaacagctagg |
342 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| || ||||| |
|
|
| T |
8659 |
ccttgattattttcacctgtatcattctcttgtgcagcaactagg |
8703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 909 times since January 2019
Visitors: 5820