View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0827_low_9 (Length: 412)
Name: NF0827_low_9
Description: NF0827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0827_low_9 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 80 - 412
Target Start/End: Original strand, 36498002 - 36498334
Alignment:
| Q |
80 |
tagattattctgtagcttgacacaatagttctgaactttcttctttgggttctttttctaaagctttgtgtttacttttggtcacaggttttatcatgtc |
179 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36498002 |
tagattcttctgtagcttgacacaatagttctgaactttcttctttgggttctttttctaaagctttgtgtttacttttggtcacaggttttatcatgtc |
36498101 |
T |
 |
| Q |
180 |
actattgtgtcttaccatgccttttatcttccactgctgtatattacatttctggcagacttttttcaggttacaatgcgctttactttatggctcgtgt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36498102 |
actattgtgtcttaccatgccttttatcttccactgctgtatattacatttctggcagacttttttcaggttacaatgcgctttactttatggctcgtgt |
36498201 |
T |
 |
| Q |
280 |
tttgttctttaatatgtaaaatgcagtattgtttgtagtttggacagtctgattgattgttcttttgattacaggaggaagattttcacatggagaatgt |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36498202 |
tttgttctttaatatgtaaaatgcagtattgtttgtagtttggacagtctgattgattgttcttttgattacaggaggaagattttcacatggagaatgt |
36498301 |
T |
 |
| Q |
380 |
gtattactctgagatgaaagatgctggtttttt |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
36498302 |
gtattactctgagatgaaagatgctggtttttt |
36498334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University