View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0828_high_2 (Length: 436)
Name: NF0828_high_2
Description: NF0828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0828_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 397; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 397; E-Value: 0
Query Start/End: Original strand, 30 - 426
Target Start/End: Complemental strand, 38357560 - 38357164
Alignment:
| Q |
30 |
tgctagtagtctaagatgtattgcttttgctcacacggagatttcagattccgaagatattgattatatgatcaaaagggagaaaaaatcacatcaaatg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38357560 |
tgctagtagtctaagatgtattgcttttgctcacacggagatttcagattccgaagatattgattatatgatcaaaagggagaaaaaatcacatcaaatg |
38357461 |
T |
 |
| Q |
130 |
cttagagaagatggattgacattgcttggcatcgttggcctcaaggatccatgcagaccaaacactaagaaagctgtggaaacttgcaaagctgcaggag |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38357460 |
cttagagaagatggattgacattgcttggcatcgttggcctcaaggatccatgcagaccaaacactaagaaagctgtggaaacttgcaaagctgcaggag |
38357361 |
T |
 |
| Q |
230 |
ttgaaattaagatgatcaccggcgataacatattcactgctaaggcaatagcaatagaatgtggaatattagattctaatagtgatcatgcaaaagctgg |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38357360 |
ttgaaattaagatgatcaccggcgataacatattcactgctaaggcaatagcaatagaatgtggaatattagattctaatagtgatcatgcaaaagctgg |
38357261 |
T |
 |
| Q |
330 |
agaagtggtggaaggtgttgaattcagaagctatacagaggaagagagaatggaaaaagtcgataatatccgagtaatggcaagatcatcccctatg |
426 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38357260 |
agaagtggtggaaggtgttgaattcagaagctatacagaggaagagagaatggaaaaagtcgataatatccgagtaatggcaagatcatcccctatg |
38357164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University