View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0828_low_11 (Length: 258)
Name: NF0828_low_11
Description: NF0828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0828_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 13 - 229
Target Start/End: Original strand, 40724509 - 40724725
Alignment:
| Q |
13 |
agacattaaaccacaactacatactctccttgatgcactttcacatgttcgaatgaagcagagcacttgtcgatgctttcattgtggtaggacttgcaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40724509 |
agacattaaaccacaactacatactctccttgatgcactttcacgtgttccaatgaaggagagcacttgtcgatgctttcattttggtaggacttgcaaa |
40724608 |
T |
|
| Q |
113 |
ctaaatagagcacagtttgcataataagaatcaacaagaacatatgagacaaaaataagaaacatacacacccaatcgttattctgctcatcgagctcag |
212 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| ||||||||||||||| ||||||| |
|
|
| T |
40724609 |
caaaatagagcacagtttgcataataagaatcaacaagaacaaatgagacaaaaataagaaacatacaaacccaattgttattctgctcatcaagctcag |
40724708 |
T |
|
| Q |
213 |
ttcaaaccacttccatc |
229 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40724709 |
ttcaaaccacttccatc |
40724725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 777 times since January 2019
Visitors: 6035