View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0828_low_5 (Length: 463)
Name: NF0828_low_5
Description: NF0828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0828_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 140 - 434
Target Start/End: Original strand, 41578684 - 41578980
Alignment:
| Q |
140 |
tttacacccctaaaatctggtagttgtgattattttagacnnnnnnnnnagtgaaaatacgaagaatttgtcttcaagacaaactcctaccatgcatatg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41578684 |
tttacacccctaaaatctggtagttgtgattattttaga-tttttttttagtgaaaatacgaagaatttgtcttcaagacaaactcctaccatgcatatc |
41578782 |
T |
 |
| Q |
240 |
aatcctt---aaaaatttgattccatggggaacttgattaaaatgggctgatgatacaattatttcaacactgaagagaaacagatctacggcgaagtga |
336 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
41578783 |
aatccttcttaaaaatttgattccatggggaactggattaaaatgggctgatgatacaattatttcaacactgaagataaaccgatctacggcgaagtga |
41578882 |
T |
 |
| Q |
337 |
tcgaagaattttagagattctcccaagtcactatgaatgagattacaactaatactttgggtacaactacgaaaatcacaagaaaaattattgcttta |
434 |
Q |
| |
|
|| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41578883 |
tcaaagaattttagagattgtcccaagtcactatgaatgagattacaactaatactttgggtacaactacgaaaatcacaagaaaaattattgcttta |
41578980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University