View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_high_28 (Length: 387)
Name: NF0829_high_28
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0829_high_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 9 - 149
Target Start/End: Original strand, 2937836 - 2937976
Alignment:
| Q |
9 |
gaaacataaagaatttttgcaaccaaatgactctggcctggttgacactcatttggtagtgagtgttgagaaaactaacacaaacagatatccatagttg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2937836 |
gaaacataaagaatttttgcaaccaaatgactctggcctggttgacactcatttggtagtgagtgttgagaaaactaacacaaacagatatccatagttg |
2937935 |
T |
|
| Q |
109 |
ttccacttggcaataacaatctctggtcaatttcagggata |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2937936 |
ttccacttggcaataacaatctctggtcaatttaagggata |
2937976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 149 - 241
Target Start/End: Original strand, 2938222 - 2938314
Alignment:
| Q |
149 |
aacggcattataagtttgactgtaaccagcattccctccaggaaaatgagatgctttgttgttggaataaagtccacgaggagagggtgacct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2938222 |
aacggcattataagtttgactgtaaccagcattccctccaggaaaatgagatgcttcgttgttggaataaagtccacgaggagagggtgacct |
2938314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1656 times since January 2019
Visitors: 6148