View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0829_high_39 (Length: 357)

Name: NF0829_high_39
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0829_high_39
NF0829_high_39
[»] chr1 (1 HSPs)
chr1 (103-278)||(3566951-3567127)


Alignment Details
Target: chr1 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 103 - 278
Target Start/End: Original strand, 3566951 - 3567127
Alignment:
103 cattatcaaccctcacaaaacatcattct-gacaactaatctcttttgctagatgttcaagttaataacatactttttgcttctcagttcaaattcatga 201  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3566951 cattatcaaccctcacaaaacatcattctagacaactaatctcttttgctagatgttcaagttaataacatactttttgcttctcagttcaaattcatga 3567050  T
202 gaatgtgggtttctcatcctgattgttccacaattgttagagatagctggagttttaatgtgattggttgccctatg 278  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
3567051 gaatgtgggtttctcatcctgattgttccacaattgttagagatagctggatttttaatgtgattggttgccctatg 3567127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 375 times since January 2019
Visitors: 6128