View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0829_high_4 (Length: 626)

Name: NF0829_high_4
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0829_high_4
NF0829_high_4
[»] chr3 (1 HSPs)
chr3 (585-621)||(51805632-51805668)


Alignment Details
Target: chr3 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 585 - 621
Target Start/End: Original strand, 51805632 - 51805668
Alignment:
585 atccaagttcttttggaatttgacctgtgaggaaatt 621  Q
    |||||||||||||||||||||||||||||||||||||    
51805632 atccaagttcttttggaatttgacctgtgaggaaatt 51805668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University